View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19141_low_12 (Length: 414)
Name: NF19141_low_12
Description: NF19141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19141_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 9e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 9e-77
Query Start/End: Original strand, 229 - 374
Target Start/End: Original strand, 34120766 - 34120911
Alignment:
| Q |
229 |
atattatatgatgagttgatacacatgggctgaaagagtcatggctgatgatgagtctataagccactcaattgttttaccaatgggaccctttcatatt |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34120766 |
atattatatgatgagttgatacacatgggctgaaagagtcatggctgatgatgagtctataagccactcaattgttttaccaatgggaccctttcatatt |
34120865 |
T |
 |
| Q |
329 |
gatgatagcaagaaattcacaacattatgatccatcataaacatta |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34120866 |
gatgatagcaagaaattcacaacattatgatccatcataaacatta |
34120911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 14 - 165
Target Start/End: Original strand, 34120554 - 34120705
Alignment:
| Q |
14 |
aatattagaattttatatatacggttgaatttggtttagttcggtttcaaggaataatcaaaaatctaatacaatcgtagtgannnnnnnatcaaacata |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||||| |||||||||| |
|
|
| T |
34120554 |
aatattagaattttatatatacggttgaatttggtttagttcggtttcaaagaataatcagaaatctaatacaattgtagtgatttttttatcaaacata |
34120653 |
T |
 |
| Q |
114 |
tccactatatactagctttatgctgtttttcaataacatttttttaattctt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34120654 |
tccactatatactagctttatgctgtttttcaataacatttttttaattctt |
34120705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University