View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19141_low_23 (Length: 261)
Name: NF19141_low_23
Description: NF19141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19141_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 18 - 253
Target Start/End: Complemental strand, 40010562 - 40010329
Alignment:
| Q |
18 |
ataaattctatgtgaattcctttatatgaaatttttgacttgctatgaaaatgtcctacattggcttt-ctcaaaccactcaacttatcatcatatccca |
116 |
Q |
| |
|
||||||||||| |||||| ||||||||||||| ||| |||| |||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
40010562 |
ataaattctatatgaatttctttatatgaaatgttttacttactatgaaaatgtcctacattggcttttctcaaaccactcaacttatcat---atccca |
40010466 |
T |
|
| Q |
117 |
ttgtagctctacaataataaaatatatttattaaaattgtcttgtaaaacctcataattaagttacatgcaaggtaaaaacttacgaattaacaaaatgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40010465 |
ttgtagctctacaataataaaatatatttattaaaattgtcttgtaaaacctcataattaagttacatgcaaggtaaacacttacgaattaacaaaatgt |
40010366 |
T |
|
| Q |
217 |
ttgatatctttctttgggtaggttgtgtattcatctc |
253 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
40010365 |
ttgacatctttccttgggtaggttgtgtattcttctc |
40010329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 125 - 161
Target Start/End: Complemental strand, 17033686 - 17033650
Alignment:
| Q |
125 |
ctacaataataaaatatatttattaaaattgtcttgt |
161 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17033686 |
ctacaataataaaatacatttattaaaattgtcttgt |
17033650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University