View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19141_low_24 (Length: 261)
Name: NF19141_low_24
Description: NF19141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19141_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 33 - 243
Target Start/End: Complemental strand, 183027 - 182817
Alignment:
| Q |
33 |
ataaacacaatcttactaaaccaacaacnnnnnnnactagttgcctaacaaacaatacattataatcggtgagaataaaagagagatttactgttagaca |
132 |
Q |
| |
|
||||||| |||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
183027 |
ataaacataatcttactaaaccaacaactttttttacttgttgcctaacaaacaatacattataatcggtgagaataaaagagggatttactgttagaaa |
182928 |
T |
|
| Q |
133 |
aacttgattgaataaagaatccttattattttactgttagttcaaaacttattctttgggaggtaaagggaattgaacaaattagattagatgaattcta |
232 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
182927 |
aacttaattgaataaagaatccttattattttactgttagttcaaaacttattttttggaaggtaaagggaattgaacaaattagattagatgaattcta |
182828 |
T |
|
| Q |
233 |
gtagcccaagc |
243 |
Q |
| |
|
||||||||||| |
|
|
| T |
182827 |
gtagcccaagc |
182817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University