View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19142_low_4 (Length: 379)
Name: NF19142_low_4
Description: NF19142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19142_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 3 - 346
Target Start/End: Complemental strand, 54220915 - 54220572
Alignment:
| Q |
3 |
aggggtgtttcgatcacctttccacccactcgcattccttcaactattgtgtacatggcttgtggaggttttggtgctgcttgtgcagagaatagaccat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54220915 |
aggggtgtttcgatcacctttccacccactcgcattccttcaactattgtgtacatggcttgtggaggttttggtgctgcttgtgcagagaatagaccat |
54220816 |
T |
|
| Q |
103 |
ttgggttgtcgacaaattcacgcttcctttcctttccgggcggagctcccaccttgaattcatatggctttcaagagtataaagcaggcattcatcagca |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54220815 |
ttgggttgtcgacaaattcacgcttcctttcctttccgggcggagctcccaccttgaattcatatggctttcaagagtataaagcaggcattcatcagca |
54220716 |
T |
|
| Q |
203 |
ttcaacacgatcacgtaaagcttaaaacaaccaatatgctttcttctagacaagagatcattaaagtatataagaaatatgactttggagatataactta |
302 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54220715 |
ttcaacacaatcacgtaaagcttaaaacaaccaatatgctttcttctagacaagagataattaaagtatataagaaatatgactttggagatataactta |
54220616 |
T |
|
| Q |
303 |
aaatgagattggggtcgggtagctcaactggtttgagctaagag |
346 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54220615 |
aaatgagattggggtcgggtggctcaactggtttgagctaagag |
54220572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 315 - 343
Target Start/End: Original strand, 13607877 - 13607905
Alignment:
| Q |
315 |
ggtcgggtagctcaactggtttgagctaa |
343 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
13607877 |
ggtcgggtagctcaactggtttgagctaa |
13607905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University