View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19143_low_15 (Length: 250)
Name: NF19143_low_15
Description: NF19143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19143_low_15 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 40464157 - 40464394
Alignment:
| Q |
13 |
aatatttattagtatctcttatatactaaatcatagtagtgattcactaagttttgaaatgattcacaagtttaatagtggattcagcacccttacattt |
112 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40464157 |
aatatttactagtatctcttatatactacatcgtagtagtgattcactaatttttggaatgattcacaagtttaatagtggattcagcacccttacattt |
40464256 |
T |
|
| Q |
113 |
atagatatacacctagttcacgcggttagaatatcagtgcccatttaatcaaatattagaaggtctaaattaaaatttacattttatgaattgtctaatt |
212 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40464257 |
atagagatacccctagttcacgcggttagaatatcagtgcccatttaatcaaatattagaaggtctaaattaaaatttacattttatgaattgtctaatt |
40464356 |
T |
|
| Q |
213 |
ttgattaaatgactaccaatgttgttacaactgcatga |
250 |
Q |
| |
|
||||||||| |||| |||||||||| |||||||||||| |
|
|
| T |
40464357 |
ttgattaaacgactgccaatgttgtcacaactgcatga |
40464394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University