View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19144_low_12 (Length: 289)
Name: NF19144_low_12
Description: NF19144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19144_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 26888932 - 26889058
Alignment:
| Q |
1 |
cgttctgctagatgacgctacattttcaggatttatcgcttgtggactatatctcacatgcaccctatctttgtttaaggtccaccattcttctgcttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26888932 |
cgttctgctagatgacgctacattttcaggatttgtcgcttgtggactatatctcgcatgcaccctatctttgtttaaggtccaccattcttctgcttga |
26889031 |
T |
 |
| Q |
101 |
tgttcacgaaactttcgtttactgcat |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
26889032 |
tgttcacgaaactttcgtttactgcat |
26889058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 169 - 277
Target Start/End: Original strand, 26889100 - 26889208
Alignment:
| Q |
169 |
tcgaatttgttggatcaacaagaagtgactgtaatacctgaatttaacacttttgaatagtcttttaccatcaggccttactattagtgtaacataaacg |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26889100 |
tcgaatttgttggatcaacaagaagtgactgtaatacctgaatttaacacttttgaatagtcttttaccatcaggccttactattagtgtaacataaacg |
26889199 |
T |
 |
| Q |
269 |
cctggttca |
277 |
Q |
| |
|
||||||||| |
|
|
| T |
26889200 |
cctggttca |
26889208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University