View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19144_low_13 (Length: 282)
Name: NF19144_low_13
Description: NF19144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19144_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 11 - 214
Target Start/End: Complemental strand, 25813541 - 25813330
Alignment:
| Q |
11 |
cagagagttctggaagcatattgttttggtggtttatttcaactacaaaaatatatttgattgaagtttgcttctgcagggttatcttttttatgtgtga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25813541 |
cagagagttctggaagcatattgttttggtggtttatttcacctacaaaa-tatatttgagtgaagtttgcttctgcagggttatcttttttatgtgtga |
25813443 |
T |
|
| Q |
111 |
aagttgttatatgatggatacattttatagttttat---------aattaaggacttgattgttgattatcaatcaatacgtttggtatgaaaagttgtg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25813442 |
aagttgttatatgatggatacattttatagttttataagtcagagaattaacgacttgattgttgattatcaatcaatacgtttggtatgaaaaattgtg |
25813343 |
T |
|
| Q |
202 |
tcaattgatattg |
214 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
25813342 |
tcagttgatattg |
25813330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 212 - 273
Target Start/End: Complemental strand, 25813272 - 25813211
Alignment:
| Q |
212 |
ttgtaccctcatgagaaggtgtaattgtttctgttaaaaaataatttaatgtgaacctatgc |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25813272 |
ttgtaccctcatgagaaggtgtaattgtttctgttaaaaaataatttaatgtgaacctatgc |
25813211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University