View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19144_low_15 (Length: 262)
Name: NF19144_low_15
Description: NF19144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19144_low_15 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 262
Target Start/End: Original strand, 26888684 - 26888928
Alignment:
| Q |
18 |
attgatctgacttgatcatacaattttcactacactatgtaaattaaacgacgcttctataccttatcatttcatgaaattaactacatgatgcctatga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26888684 |
attgatctgacttgatcatacaattttcactacactatgtaaattaaacgacgcttctataccttatcatttcatgaaattaactacatgatgcctatga |
26888783 |
T |
 |
| Q |
118 |
agactgggatttaagtttagggaggtgtggcctcattgttttcttcagctggcggcgggttactgctagatgatgctacatcttcttgatttgcaggtgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26888784 |
agactgggatttaagtttagggaggtgtggcctcattgttttcttcagctggcggcgggttactgctagatgatgctacatcttcttgatttgcaggtgg |
26888883 |
T |
 |
| Q |
218 |
tgggttactgctagatgatgcaacatcttcttgatttgcaggtgg |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26888884 |
tgggttactgctagatgatgcaacatcttcttgatttgcaggtgg |
26888928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 174 - 235
Target Start/End: Original strand, 26888885 - 26888946
Alignment:
| Q |
174 |
gggttactgctagatgatgctacatcttcttgatttgcaggtggtgggttactgctagatga |
235 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
26888885 |
gggttactgctagatgatgcaacatcttcttgatttgcaggtggtggcgttctgctagatga |
26888946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University