View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19145_low_18 (Length: 382)
Name: NF19145_low_18
Description: NF19145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19145_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-109; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 113 - 364
Target Start/End: Complemental strand, 42039223 - 42038973
Alignment:
| Q |
113 |
tcggtatgtgctattttctcaagccnnnnnnncttttcgagatgttgctttttgtgctgatattggtctatgatgcatattccttannnnnnnagtcttg |
212 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
42039223 |
tcggtatgtgctattttctcaagcctttttttcttttcgagatgttgctttttgtgctgatatttgtctatgatgcatattccttatttttt-agtcttg |
42039125 |
T |
|
| Q |
213 |
tacccttctttagaaggttttttcatgccgccacacactagtttctttttgaggtgttgttatgcaacctaagacaacaatgaatgcaaaacacatacac |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42039124 |
tacccttctttagaaggttttttcatgccgccacacactagtttctttttgaggtgttgttatgcaacctaagacaacaatgaatgcaaaacacatacac |
42039025 |
T |
|
| Q |
313 |
ggtgcacatggagagaagggtgaggtcggcgcagggagagggctgctgcctg |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42039024 |
ggtgcacatggagagaagggtgaggtcggcgcagggagagggctgctgcctg |
42038973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 42039915 - 42039844
Alignment:
| Q |
1 |
atatgtgacaaatttgtctatggtataaccaaaataatgaaaacttcatnnnnnnntcatgtattaccttta |
72 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
42039915 |
atatgtgacaaatttgtctatggtataactaaaataatgaaaactccataaaaaaatcatgtattaccttta |
42039844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University