View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19145_low_24 (Length: 334)
Name: NF19145_low_24
Description: NF19145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19145_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 2e-74; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 180 - 329
Target Start/End: Complemental strand, 41557046 - 41556897
Alignment:
| Q |
180 |
gaagggttctctctattaatattcgtttgtagagcagaaattattttatgttgaacgtaatacctgtaacctggtggtttgtgagggaaattgaattggg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41557046 |
gaagggttctctctattaatattcgtttgtagagcagaaattattttacgttgaacttaatacctgtaacctggtggtttgtgagggaaattgaattggg |
41556947 |
T |
|
| Q |
280 |
gagatgttaagactttgaggtaatctctccaaaaatgtacactctctgct |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41556946 |
gagatgttaagactttgaggtaatctctccaaaaatgtacactctctgct |
41556897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 228 - 329
Target Start/End: Complemental strand, 41561871 - 41561769
Alignment:
| Q |
228 |
tgttgaacgtaat-acctgtaacctggtggtttgtgagggaaattgaattggggagatgttaagactttgaggtaatctctccaaaaatgtacactctct |
326 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |||||||||||| ||| | ||||||| |
|
|
| T |
41561871 |
tgttgaacttaatcacctgtaacctggtggtttgtgagggaaactgaattggggagatgttaagagtttgagataatctctccaataattaaaactctct |
41561772 |
T |
|
| Q |
327 |
gct |
329 |
Q |
| |
|
||| |
|
|
| T |
41561771 |
gct |
41561769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 53 - 106
Target Start/End: Complemental strand, 41557199 - 41557146
Alignment:
| Q |
53 |
agtcaaatggttcaatttctaatatacattgtcatatgaaagttatcattttag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41557199 |
agtcaaatggttcaatttctaatatacattttcatatgaaagttatcattttag |
41557146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University