View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19145_low_31 (Length: 275)
Name: NF19145_low_31
Description: NF19145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19145_low_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 22 - 232
Target Start/End: Complemental strand, 33942969 - 33942759
Alignment:
| Q |
22 |
gaacttggtgtggaaaaagacaataggataatttgttgaattcacccaaaatgtcatctctccctgaagaactatggagcagaattctggaaatcggaat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33942969 |
gaacttggtgtggaaaaagacaataggatactttgttgaattcacccaaaatgtcatctctccctgaagaactatggagcagaattctggaaatcggaat |
33942870 |
T |
|
| Q |
122 |
tgaaaaaagcagcttgagctacaaggatctctgttgcatctcaatctcttgccacctccttcaccgcctttcctctgatgactctctctggaacggcctt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33942869 |
tgaaaaaagcagcttgagctacaaggatctctgttgcatctcaatctcttgccacctccttcaccgcctttcctctgatgactctctctggaacggcctt |
33942770 |
T |
|
| Q |
222 |
atctcctccga |
232 |
Q |
| |
|
||||||||||| |
|
|
| T |
33942769 |
atctcctccga |
33942759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 69 - 232
Target Start/End: Complemental strand, 33934741 - 33934578
Alignment:
| Q |
69 |
aaaatgtcatctctccctgaagaactatggagcagaattctggaaatcggaattgaaaaaagcagcttgagctacaaggatctctgttgcatctcaatct |
168 |
Q |
| |
|
|||||||| |||||||| |||||||||| || |||||| ||||||||||| || | || | ||||||||||| || ||||| ||||||||||||| |
|
|
| T |
33934741 |
aaaatgtcgtctctcccaatcgaactatggaccaaaattctcgaaatcggaatccaagattgcggtttgagctacaaagacctctgctgcatctcaatct |
33934642 |
T |
|
| Q |
169 |
cttgccacctccttcaccgcctttcctctgatgactctctctggaacggccttatctcctccga |
232 |
Q |
| |
|
| |||| ||||||||||||||| ||| ||| || |||||||||||| ||||| |||||||||| |
|
|
| T |
33934641 |
cctgccgcctccttcaccgcctctccgttgaagattctctctggaaccgccttctctcctccga |
33934578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University