View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19147_high_14 (Length: 237)
Name: NF19147_high_14
Description: NF19147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19147_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 36 - 221
Target Start/End: Complemental strand, 37526274 - 37526089
Alignment:
| Q |
36 |
ttgaatagcggtggtaaatggtagtggtggtatagtaatgacaatgagtgagtgaagggaaagagaaattcgaaaaatggggggagtgatgtgtgattga |
135 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37526274 |
ttgaatagtggtggtaaatggtagtggtggtatagtaatgacaatgagtgagtgaagggaaagagaaattcgaaaaatggggggagtgatgtgtgattga |
37526175 |
T |
|
| Q |
136 |
ttgaatgtgtgagtgattgatttattgttagttttttaagattgagttgagtggttgaatgaacatgaagatgataaagaaagggg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37526174 |
ttgaatgtgtgagtgattgatttattgttagttttttaagattgagttgagtggttgaatgaacatgaagatgataaagaaagggg |
37526089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University