View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19147_low_16 (Length: 237)

Name: NF19147_low_16
Description: NF19147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19147_low_16
NF19147_low_16
[»] chr1 (1 HSPs)
chr1 (36-221)||(37526089-37526274)


Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 36 - 221
Target Start/End: Complemental strand, 37526274 - 37526089
Alignment:
36 ttgaatagcggtggtaaatggtagtggtggtatagtaatgacaatgagtgagtgaagggaaagagaaattcgaaaaatggggggagtgatgtgtgattga 135  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37526274 ttgaatagtggtggtaaatggtagtggtggtatagtaatgacaatgagtgagtgaagggaaagagaaattcgaaaaatggggggagtgatgtgtgattga 37526175  T
136 ttgaatgtgtgagtgattgatttattgttagttttttaagattgagttgagtggttgaatgaacatgaagatgataaagaaagggg 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37526174 ttgaatgtgtgagtgattgatttattgttagttttttaagattgagttgagtggttgaatgaacatgaagatgataaagaaagggg 37526089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University