View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19148_low_5 (Length: 240)
Name: NF19148_low_5
Description: NF19148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19148_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 10 - 219
Target Start/End: Original strand, 12809523 - 12809731
Alignment:
| Q |
10 |
ataatactcgtagtatgttcgacttgtaaagtattttcgttttagggttggnnnnnnnnntcatgaaaattgaaacaaattttgcatttttgtctctcta |
109 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
12809523 |
ataacactcatagtatgttcgacttgtaaagtattttcgttttagggttggaaaaaaaa-tcatggaaattgaaacaaattttgcatttttgtgtctcta |
12809621 |
T |
|
| Q |
110 |
gtgtacatttggatgtgaggcgagattggcataagctatgtgattcttaatttggtaacatggtgggttagccgaatttccagtgagccgcgacaatttc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
12809622 |
gtgtacatttggatgtgaggcgagattggcataagctatgtgattcttaatttggtaatatggtgggttagccgaaatttcagtgagccgcgacaatttc |
12809721 |
T |
|
| Q |
210 |
aacaaaccat |
219 |
Q |
| |
|
|||||||||| |
|
|
| T |
12809722 |
aacaaaccat |
12809731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 10 - 57
Target Start/End: Complemental strand, 12809388 - 12809341
Alignment:
| Q |
10 |
ataatactcgtagtatgttcgacttgtaaagtattttcgttttagggt |
57 |
Q |
| |
|
||||||||| ||||||||| |||||||||| |||||||||||| |||| |
|
|
| T |
12809388 |
ataatactcatagtatgttggacttgtaaattattttcgttttggggt |
12809341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University