View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19149_low_16 (Length: 246)
Name: NF19149_low_16
Description: NF19149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19149_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 11 - 229
Target Start/End: Complemental strand, 1830210 - 1829992
Alignment:
| Q |
11 |
agaaaataataacaaatagaaaaacttgaactagttttccttgagtcaccaatgcataacaaagttaaagaaaacataaacactgaaattcattaacaaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1830210 |
agaaaataataacaaatagaaaaacttgaactagttttccttgagtcaccaatgcataacaaagttaaagaaaacataaacactgaaattcattaacaaa |
1830111 |
T |
 |
| Q |
111 |
agaaagatttggttaattacctcttaatggctcggacaaggtcaagtgaagaagggtgtcgcatacggtggagaaaatcatggaaagacgttgatcttga |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1830110 |
agaaagatttggttaattacctcttaatggctcggacgaggtcaagtgaagaagggtgtcgcatacggtggagaaaatcatggaaagacgttgatcttga |
1830011 |
T |
 |
| Q |
211 |
tgatgatgctgatccttcc |
229 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
1830010 |
tgatgatgctgatccttcc |
1829992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University