View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19149_low_18 (Length: 236)

Name: NF19149_low_18
Description: NF19149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19149_low_18
NF19149_low_18
[»] chr2 (1 HSPs)
chr2 (1-220)||(43808081-43808300)


Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 43808081 - 43808300
Alignment:
1 tattgtatgtctatgttttgtagaagccagataaatataaatattgctttatttgggttataataattgtatgtgaaagcttaacatgacataattaata 100  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
43808081 tattttatgtctatgttttgtagaagccagataaatataaatattgctttatttgggttataataattgtatgtgaaagcttaacataacataattaata 43808180  T
101 tgcaggagtggctctgtagtagcaaagtatggtgacaagagtgtgtactttgatttggaggatattggcaacactacaggtcagtgggatttgtacggct 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43808181 tgcaggagtggctctgtagtagcaaagtatggtgacaagagtgtgtactttgatttggaggatattggcaacactacaggtcagtgggatttgtacggct 43808280  T
201 cagatgcaccctcaccctac 220  Q
    ||||||||||||||||||||    
43808281 cagatgcaccctcaccctac 43808300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University