View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19149_low_21 (Length: 218)
Name: NF19149_low_21
Description: NF19149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19149_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 15 - 212
Target Start/End: Original strand, 30710788 - 30710988
Alignment:
| Q |
15 |
aattattctacaagtggttctagttgcttttctggtatttctatggagtttccgttgctacaccagatataggaggaggcgttcccgctgaattaaaaga |
114 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30710788 |
aattattctacaagtggttgtagttgcttttctggtatttctatggagtttccgttgctacaccagatataggaggaggcgttcccgctgaattaaaaga |
30710887 |
T |
|
| Q |
115 |
gaccttggtgtttacatgattttgaactgtggtaatattttaaatatattcttcattctccctttgtcagttctacttg---attgtgaattgatgatgt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| ||| |||||||||||||| |
|
|
| T |
30710888 |
gaccttggtgtttacatgattttgaactgtggtaatattttaaatatattcttcattctccctttctcagttcttcttgattattatgaattgatgatgt |
30710987 |
T |
|
| Q |
212 |
c |
212 |
Q |
| |
|
| |
|
|
| T |
30710988 |
c |
30710988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University