View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1914_high_17 (Length: 281)
Name: NF1914_high_17
Description: NF1914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1914_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 258; Significance: 1e-144; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 32667827 - 32667562
Alignment:
| Q |
1 |
cccaaatgcgataacctttactcgttaaatattttctcacttgaaacttgtattctgccactgacaccaattcattagtaggatctctgcaatggaggga |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32667827 |
cccaaatgcgataacctttactagttaaatattttctcacttgagacttgtattctgccactgacaccaattcattagtaggatctctgcaatggaggga |
32667728 |
T |
 |
| Q |
101 |
gaggggatttagttaaactgttatgaggagcaaatgaattataagaattagttagatataaagagaggaaaaactggtttgaactgacctcaaaataaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32667727 |
gaggggatttagttaaactgttatgaggagcaaatgaattataagaattagttagatataaagagaggaaaaactggtttgaactgacctcaaaataaga |
32667628 |
T |
 |
| Q |
201 |
cctgtccacccatggtaaccgacattgacaaggttatcgattgtagctgatctgagatgttccctc |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32667627 |
cctgtccacccatggtaaccgacattgacaaggttatcgattgtagctgatctgagatgttccctc |
32667562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 204 - 266
Target Start/End: Complemental strand, 16940098 - 16940036
Alignment:
| Q |
204 |
gtccacccatggtaaccgacattgacaaggttatcgattgtagctgatctgagatgttccctc |
266 |
Q |
| |
|
|||||||||| ||||| ||||||| ||| || || ||||| ||||||||||||||||||||| |
|
|
| T |
16940098 |
gtccacccataataaccaacattgagaagattgtcaattgtggctgatctgagatgttccctc |
16940036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University