View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1914_low_31 (Length: 226)
Name: NF1914_low_31
Description: NF1914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1914_low_31 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 26579902 - 26580128
Alignment:
| Q |
1 |
cactttacactataggaagacaagaatcacgttgttcattgaatttttagattcataaaataaaagaacatgtgcaggtacttaatttt-gacaattttt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26579902 |
cactttacattataggaagacaagaatcacgttgttcattgaatttttagattcataaaataaaagaacatgtgcaggtacttaatttttgacaattttt |
26580001 |
T |
 |
| Q |
100 |
aatcatcaacttacctaactagacttattatcttgacagcagtatggattcaaattgactttgaaatttgaatcccatgtgggcatgacaataatttatg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
26580002 |
aatcatcaacttacctaactagacttattatcttgacagcagtatggattcaaattgactttgaaatttgaatcccatgtgggcatgacaataattgatg |
26580101 |
T |
 |
| Q |
200 |
tggagaggtttttaattgctatgatga |
226 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
26580102 |
tggagaggtttttaattgctataatga |
26580128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University