View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1914_low_32 (Length: 224)
Name: NF1914_low_32
Description: NF1914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1914_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 74 - 216
Target Start/End: Original strand, 32096969 - 32097111
Alignment:
| Q |
74 |
aaagaggattggttagaggaagtgatgtagttgatggaaggtgaagaatcgatagtccattgtgttgattggttttgaagaatggttgaaacagtttgag |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32096969 |
aaagaggattggttagaggaagtgatgtagttgatggaaggtgaagaatcgatagtccattgtgttgattggttttgaagaatggttgaaacagtttgag |
32097068 |
T |
 |
| Q |
174 |
agtagtgtgtgtcttcttgtgttaagtcttctagttgatgatg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32097069 |
agtagtgtgtgtcttcttgtgttaagtcttctagttgatgatg |
32097111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University