View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1914_low_8 (Length: 466)
Name: NF1914_low_8
Description: NF1914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1914_low_8 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 445; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 445; E-Value: 0
Query Start/End: Original strand, 2 - 466
Target Start/End: Complemental strand, 24800912 - 24800448
Alignment:
| Q |
2 |
aaggtaacttgcaaaaaggtttgcatctaaatggtggaaggatattgtcaatatggaggaggatgtaggtctaaattggtttaattcaaaggtagtaagg |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24800912 |
aaggtaacttgcaaaaaggtttgcatctaaatggtggaaggatattgtcaatatggaggaggatgtaggtctaaattggtttaattcgaaggtagtaagg |
24800813 |
T |
|
| Q |
102 |
agagtggataatgacttggatactaattttttgaatgtggtgtggcgaagggaaatgacgctgcatgcgaaataccctaggctttactcaatatcaaacc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24800812 |
agagtggataatgacttggatactaattttttgaatgtggtgtggcgaagggaaatgacgctgcatgcgaaataccctaggctttactcaatatcaaacc |
24800713 |
T |
|
| Q |
202 |
aacaagaaacttaaggagagattgacgagggtggagagtagaggttttcttggagacattgtttctctcattaggaggaacaacatctaaatgttttgcg |
301 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24800712 |
aacaagaaactttaggagagattgacgagggtggagagtagaggttttcttggagacattgtttctctcattatgaggaacaacatctaaatgttttgcg |
24800613 |
T |
|
| Q |
302 |
ggatgatttggaggattttgtgtggtcacaagagaaggatgtttggaggtggagattgaaggaggacggagttttttcggtgaagtcatcatatgttaaa |
401 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24800612 |
ggatgatttggagggttttgtgtggtcacaagagaaggatgtttggaggtggagattgaaggaggacggagttttttcggtgaagtcatcatatgttaaa |
24800513 |
T |
|
| Q |
402 |
ttagaaaatttaatgttgttagacgagaagtggtgagaggatgagaagaaggtctttgataagtt |
466 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24800512 |
ttagaaaatttaatgttgttagaagagaagtggtgagaggatgagaagaaggtctttgataagtt |
24800448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University