View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19150_high_9 (Length: 207)
Name: NF19150_high_9
Description: NF19150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19150_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 19 - 183
Target Start/End: Original strand, 51424788 - 51424952
Alignment:
| Q |
19 |
atgccatgataagagatttcagaatattttggtgttttcgtgcttccttttttctagatttcctcctaacttattgattttggtgagttttatggtgaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
51424788 |
atgccatgataagagatttcagaatattttggtgttttcgtgcttccttttttctagatttcctcctagcttattgattttggtgagttttatggtgaaa |
51424887 |
T |
|
| Q |
119 |
gattttacttggttgtttaagaggtcatgttttaagtttaggatattgcattaggaagatcgagc |
183 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51424888 |
gattttacttggttgtttaagaggttatgttttaagtttaggatattgcattaggaagatcgagc |
51424952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University