View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19150_low_1 (Length: 604)
Name: NF19150_low_1
Description: NF19150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19150_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 3e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 3e-77
Query Start/End: Original strand, 163 - 313
Target Start/End: Complemental strand, 39540358 - 39540208
Alignment:
| Q |
163 |
agtagtttttccttgttgtttctgcttcacccatctcaaggagaatttatcatcattaggatatattttggaaaatgcttaatgtcacaaaacattattt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39540358 |
agtagtttttccttgttgtttctgcttcacccatctcaaggagaatttatcatcattaggatatattttggaaaatgcttaatgtcgcaaaacattattt |
39540259 |
T |
 |
| Q |
263 |
cttgaaaaaacacgaataggctgacaaagggtaaaacgttgaaaacaagta |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39540258 |
cttgaaaaaacacgaataggctgacaaagggtaaaacgttgaaaacaagta |
39540208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 434 - 520
Target Start/End: Original strand, 437632 - 437718
Alignment:
| Q |
434 |
gtttgtgccgagtcggagcgcgccgagtctctgagtttgattcggtttaaggatgatatgtattttccttcctactaaattgcattg |
520 |
Q |
| |
|
||||||| ||||||||| || || ||||||| |||||| | |||||| |||||||| || ||||||||||||| ||||||||||||| |
|
|
| T |
437632 |
gtttgtgtcgagtcggaacgtgctgagtctccgagtttcactcggttcaaggatgagatctattttccttcctcctaaattgcattg |
437718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 30190274 - 30190303
Alignment:
| Q |
1 |
ttcccccatccaaacacactctaaggttaa |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
30190274 |
ttcccccatccaaacacactctaaggttaa |
30190303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University