View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19150_low_9 (Length: 238)

Name: NF19150_low_9
Description: NF19150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19150_low_9
NF19150_low_9
[»] chr1 (1 HSPs)
chr1 (1-221)||(16646929-16647148)
[»] chr3 (1 HSPs)
chr3 (15-67)||(40770553-40770605)


Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 16647148 - 16646929
Alignment:
1 ttttaactgttaaaatgctttcttacttgtagcagaagattaacaatatcatgtctatgaatgaccacaatcacggctcaacgcaacatttgagtaacaa 100  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
16647148 ttttaactgttaaaatgctttcttacttgtagcagaacattaacaatatcatgtctatgaatgaccacaatcaaggctcaacgcaacatttgagtaacaa 16647049  T
101 tagcaatggaactgcaagtagttcgtatgaatatgagaatggggattgtgagtttgaagatgaggtgcatgagcatgttttttaagaagatgtgaatgag 200  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |||||||| ||||||||    
16647048 tagcaatggaactgcaagtagttcgtatgaatatgagaat-gggattgttagtttgaagatgaggtgcatgagcatgtttttgaagaagatatgaatgag 16646950  T
201 aatatgaatgaggatgaggat 221  Q
    |||||||||||||||||||||    
16646949 aatatgaatgaggatgaggat 16646929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 67
Target Start/End: Complemental strand, 40770605 - 40770553
Alignment:
15 atgctttcttacttgtagcagaagattaacaatatcatgtctatgaatgacca 67  Q
    |||| ||||||||||||| |||| || || ||||||||||||||| |||||||    
40770605 atgccttcttacttgtagaagaacatcaagaatatcatgtctatggatgacca 40770553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University