View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19152_low_21 (Length: 237)
Name: NF19152_low_21
Description: NF19152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19152_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 91 - 222
Target Start/End: Complemental strand, 40722202 - 40722071
Alignment:
| Q |
91 |
caaacgtaaacaccctcttcttcttttgttctctagctgtctttttcccatgcttttctatagctcttaccaccataaacatggttctgttcttgcaaga |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40722202 |
caaacgtaaacaccctcttcttcttttgttctctagctgtctttttcccatgcttttctatagctcttaccaccataaacatggttatgttcttgcaaga |
40722103 |
T |
|
| Q |
191 |
tccatcacaaaatagaggtagttttagatttt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40722102 |
tccatcacaaaatagaggtagttttagatttt |
40722071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 91 - 222
Target Start/End: Complemental strand, 16003858 - 16003727
Alignment:
| Q |
91 |
caaacgtaaacaccctcttcttcttttgttctctagctgtctttttcccatgcttttctatagctcttaccaccataaacatggttctgttcttgcaaga |
190 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16003858 |
caaacgtaaacaccctcttcttcttttattctctagctgtctttttcccatgcttttctatagctcttaccaccataaacatggttctgttcttgcaaga |
16003759 |
T |
|
| Q |
191 |
tccatcacaaaatagaggtagttttagatttt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
16003758 |
tccatcacaaaatagaggtagttttagatttt |
16003727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 91 - 220
Target Start/End: Complemental strand, 26795241 - 26795109
Alignment:
| Q |
91 |
caaacgtaaacaccctcttcttctt---ttgttctctagctgtctttttcccatgcttttctatagctcttaccaccataaacatggttctgttcttgca |
187 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26795241 |
caaacgtaaacaccctcttcttcttcttttgttctctagctgtctttttcccatgcttttctacagctgttaccaccataaacatggttctgttcttgca |
26795142 |
T |
|
| Q |
188 |
agatccatcacaaaatagaggtagttttagatt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26795141 |
agatccatcacaaaatagaggtagttttagatt |
26795109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 30 - 93
Target Start/End: Complemental strand, 16004469 - 16004408
Alignment:
| Q |
30 |
taacatttcttcttaacaaacctttctacaaactgcgcacataagagaaggaaagtgtctgcaa |
93 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||| |||||||| ||||| ||||||||||||| |
|
|
| T |
16004469 |
taacatgtcttcttgacaaacctttctacaaact--gcacataaaagaagaaaagtgtctgcaa |
16004408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 91 - 220
Target Start/End: Original strand, 27221880 - 27222009
Alignment:
| Q |
91 |
caaacgtaaacaccctcttcttcttttgttctctagctgtctttttcccatgcttttctatagctcttaccaccataaacatggttctgttcttgcaaga |
190 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27221880 |
caaacgtaaacaacctcttcttcttttgttctctagctgtctttttcccatgcttttctgcagctcttaccaccataaatatggttctgttcttgcaaga |
27221979 |
T |
|
| Q |
191 |
tccatcacaaaatagaggtagttttagatt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27221980 |
tccatcacaaaatagaggtagttttagatt |
27222009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University