View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19152_low_22 (Length: 212)
Name: NF19152_low_22
Description: NF19152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19152_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 18 - 197
Target Start/End: Original strand, 36041297 - 36041476
Alignment:
| Q |
18 |
acaagtatgggagttagtacattagtattaagaataaaggctcgaaatgatgtgtgacaaaaaatttatttgccctctgataatcaaaagtaatatttaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36041297 |
acaagtatgggagttagtacattagtattaagaataaaggctcgaaatgatgtgtgacaaaaaatttatttgccctctgataatcaaaagtaatatttaa |
36041396 |
T |
 |
| Q |
118 |
aaatctcaaacatcgtcaatttagtccttgattaggactataataatatcttgaaaaattatctgacatagaaccaaatt |
197 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36041397 |
aaatctcaaatatcgtcaatttagtccttgattaggactataataatatcttgaaaaattatctgacatagaaccaaatt |
36041476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University