View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19152_low_23 (Length: 206)
Name: NF19152_low_23
Description: NF19152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19152_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 109 - 188
Target Start/End: Complemental strand, 5035966 - 5035887
Alignment:
| Q |
109 |
aaaacatctataaatttgctttaggtcccaaaaaagtttggaccaatctgtatgatcattaaagcaaattttacagcttc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5035966 |
aaaacatctataaatttgctttaggtcccaaaaaagtttggaccaatctgtatgatcattaaagcaaattttacagcttc |
5035887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 19 - 84
Target Start/End: Complemental strand, 5036063 - 5035998
Alignment:
| Q |
19 |
ctttgacacataatttaaattttagacggggtgatatttattttaattttataaaagtcttacata |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5036063 |
ctttgacacataatttaaattttagacggggtgatatttattttaattttataaaagtcttacata |
5035998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University