View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19156_high_3 (Length: 390)
Name: NF19156_high_3
Description: NF19156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19156_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 268; Significance: 1e-149; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 375
Target Start/End: Complemental strand, 13578015 - 13577640
Alignment:
| Q |
1 |
tgtgattagttattggtatctagtagatagtctgcactactaacccaacnnnnnnnctagagagagatagtgtaaactggtgattagtgagtggaatagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
13578015 |
tgtgattagttattggtatctagtagatagtctgcactactaacacaacaaaaaaactagagagagatagtgtaaactggtgattagtgagtggaatggg |
13577916 |
T |
|
| Q |
101 |
agaccctattaannnnnnnnnnnnnatataccttaatttgtgccccgagagcaacgattaacacaactcatttttaaattggttactggctttgttaata |
200 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||| |||||| |||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
13577915 |
agaccctattaattttttcttttttagataccttaatttgtgccccaagagcaccgattaacacaacttatttttaaattggttactgactttgttaata |
13577816 |
T |
|
| Q |
201 |
attcaaaatggtcactatctttgtctaaccatcatcctaacaaacatgtca-ccccttaatattcagcccaacaactccatattttttcccaatctacac |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13577815 |
attcaaaatggtcactatctttgtctaaccatcatcctaacaaacatgtcatccccttactattcagcccaacaactccatattttttcccaatttacac |
13577716 |
T |
|
| Q |
300 |
gaccaatgcttggtctattattcttttcattccatttccaatatccatcaattccttggtgaggtggagaatatga |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13577715 |
gaccaatgcttggtctattattcttttcattccatttccaatatccatcaattccttggtgaggtggataatatga |
13577640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 259 - 336
Target Start/End: Complemental strand, 13566362 - 13566285
Alignment:
| Q |
259 |
atattcagcccaacaactccatattttttcccaatctacacgaccaatgcttggtctattattcttttcattccattt |
336 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||| | |||| ||| | || ||||||||||||||||||||||||| |
|
|
| T |
13566362 |
atattcagcacaacaactccatcttttttcccaatttgcacggccagtatttagtctattattcttttcattccattt |
13566285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 336 - 373
Target Start/End: Complemental strand, 13566253 - 13566216
Alignment:
| Q |
336 |
tccaatatccatcaattccttggtgaggtggagaatat |
373 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
13566253 |
tccaatatccgtcaatgccttggtgaggtggagaatat |
13566216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University