View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19156_low_11 (Length: 210)
Name: NF19156_low_11
Description: NF19156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19156_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 13 - 191
Target Start/End: Complemental strand, 48706266 - 48706089
Alignment:
| Q |
13 |
aagaatatgcataattttgcgaaggttcttagagaaccttgtgagagaagtaaaatgagcaaaatgttttgatatagagtctagacctgccgtgacacat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48706266 |
aagaatatgcataattttgcgaaggttcttagagaacct-gtgagagaagtaaaatgagcaaaatgttctgatatagagtctagacctgccgtgacacat |
48706168 |
T |
 |
| Q |
113 |
cctaaccaaagagagagtaaataccaaatcttcccaaaatatcgcaacgaatgaacaaatgattaacatcatcgtccct |
191 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||| || |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48706167 |
cctaaccaaagagagagcaaagaccaaatcttcccaaaaaattgcaacgaacgaacaaatgattaacatcatcgtccct |
48706089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 33 - 122
Target Start/End: Complemental strand, 27163263 - 27163176
Alignment:
| Q |
33 |
gaaggttcttagagaaccttgtgagagaagtaaaatgagcaaaatgttttgatatagagtctagacctgccgtgacacatcctaaccaaa |
122 |
Q |
| |
|
|||| ||||||||||| ||||||||||| |||||||||||||||| | |||||||||| |||||| || ||||| || |||||||||| |
|
|
| T |
27163263 |
gaagattcttagagaaacttgtgagaga--taaaatgagcaaaatgatctgatatagagcctagacttgttgtgacgcaccctaaccaaa |
27163176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University