View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19156_low_7 (Length: 251)
Name: NF19156_low_7
Description: NF19156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19156_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 8362443 - 8362214
Alignment:
| Q |
1 |
agatcaccaaatatgtttaacaaccataaattcatgtaacaactccaattagtttatctataaatatgattctcattactgttccttacacaaacatata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8362443 |
agatcaccaaatatgtttaacaaccataaattcatgtaacaactccaattagtttatctataaatatcattctcattactgttccttacacaaacatata |
8362344 |
T |
|
| Q |
101 |
a--acaacaaattaatttcaattgtgatttgaaacatggcatcaactaatactattggcatggtgttgctcatgatgataatggtgtccttaacttctct |
198 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8362343 |
attacaacaaattaatttcaattgtgatttgaaacatggcatca------actattggaatggtgttgctcatgatgataatggtgtccttaacttctct |
8362250 |
T |
|
| Q |
199 |
agcaagtgcattaagtgtgaattactatgaacatac |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
8362249 |
agcaagtgcattaagtgtgaattactatgaacatac |
8362214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University