View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19158_low_2 (Length: 277)
Name: NF19158_low_2
Description: NF19158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19158_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 107 - 262
Target Start/End: Complemental strand, 19540802 - 19540648
Alignment:
| Q |
107 |
ttattccagcattccttatgccaaacttggtttaatcaaccttattgctttgttttggttggttggtagtggtgttaaaccaaattatttaaaatgacgt |
206 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
19540802 |
ttattccagcattccttttgccaaacttggtttaat-aaccttattgctttgttttggttggttggtagtggtattaagccaaattatttaaaatgacgt |
19540704 |
T |
|
| Q |
207 |
ggcattgtatgtttaaaaatgaaaatgtgtgaaacttattgaaatttattttaagt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19540703 |
ggcattgtatgtttaaaaatgaaaatgtgtgaaacttattgaaatttattttaagt |
19540648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 57 - 203
Target Start/End: Original strand, 18476038 - 18476184
Alignment:
| Q |
57 |
actatgttgaataataaaatagaattacatgtccctatttcttatttattttattccagcattccttatgccaaacttggtttaatcaaccttattgctt |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| ||||||| || ||| |||||||||||||||||||||||| |
|
|
| T |
18476038 |
actatgttgaataataaaatagaattacatgtctctatttcttatttaatttattccaacattcctcttggaaaaattggtttaatcaaccttattgctt |
18476137 |
T |
|
| Q |
157 |
tgttttggttggttggtagtggtgttaaaccaaattatttaaaatga |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18476138 |
tgttttggttggttggtagtggtgttaaaccaaattatttaaaatga |
18476184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 147 - 227
Target Start/End: Original strand, 28189627 - 28189703
Alignment:
| Q |
147 |
cttattgctttgttttggttggttggtagtggtgttaaaccaaattatttaaaatgacgtggcattgtatgtttaaaaatg |
227 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||| ||| |||||||||||||| || ||||||||| |||||||| |
|
|
| T |
28189627 |
cttattgctttgttttgg----ttggtagtgatgttaaatcaagttatttaaaatgacatgaaattgtatgtataaaaatg |
28189703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University