View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1915_high_7 (Length: 238)
Name: NF1915_high_7
Description: NF1915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1915_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 21713643 - 21713864
Alignment:
| Q |
1 |
atgaagcaaagtcgagatgttattaggttgagttttaatgtgtttgggccagtgtttccttaaccagtatctcatggacactaattggcatacctgtaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21713643 |
atgaagcaaagtcgagatgttattaggttgagttttaatgtgtttggaccaatgtttccttaaccagtatctcatggacactaattggcatacctgtaag |
21713742 |
T |
|
| Q |
101 |
aggcagaactactctagggcaagggtgggtcatggttcacccagg-aaaaaattcatagatgtaccctacaaagaaatgtttcatttagcggcagtttct |
199 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21713743 |
aggcagaactactcta-ggcaagggtgggtcatggttcacccaggaaaaaaattcatagatgtaccctacaaagaaatgtttcatttagcggcagtttct |
21713841 |
T |
|
| Q |
200 |
tttccatttcgcagggtttataa |
222 |
Q |
| |
|
|||||||||||| |||||||||| |
|
|
| T |
21713842 |
tttccatttcgcggggtttataa |
21713864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University