View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1915_low_10 (Length: 237)
Name: NF1915_low_10
Description: NF1915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1915_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 3008480 - 3008700
Alignment:
| Q |
1 |
cactggtggagacactggaatagcaatatcaaagaagtctgcaatggttcctcttcaaatggagcttggtggaaaagatgcttgcattgttcttgaagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3008480 |
cactggtggagacactggaatagcaatatcaaagaagtctgcaatggttcctcttcaaatggagcttggtggaaaagatgcttgcattgttcttgaagat |
3008579 |
T |
 |
| Q |
101 |
gctgacttggatttggtagctgctaacattgtgaaaggagggttctcatacaggtaacagtagcacatatatagtaccatgtcaattagatacgcagact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3008580 |
gctgacttggatttggtagctgctaacattgtgaaaggagggttctcatacaggtaacagtagcacatatatagtaccatgtcatttagatacgcagact |
3008679 |
T |
 |
| Q |
201 |
tgtagtttctcgctatatttc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3008680 |
tgtagtttctcgctatatttc |
3008700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 54726196 - 54726042
Alignment:
| Q |
1 |
cactggtggagacactggaatagcaatatcaaagaagtctgcaatggttcctcttcaaatggagcttggtggaaaagatgcttgcattgttcttgaagat |
100 |
Q |
| |
|
|||||||||||| || || || ||||| ||||||||| | | ||| |||| | |||||||| | || |||||||||||||||||||| ||||||||| |
|
|
| T |
54726196 |
cactggtggagataccggcattgcaatttcaaagaaggcaggcatgattccgttacaaatggaattgggaggaaaagatgcttgcattgtacttgaagat |
54726097 |
T |
 |
| Q |
101 |
gctgacttggatttggtagctgctaacattgtgaaaggagggttctcatacaggt |
155 |
Q |
| |
|
|||||| | |||||||| ||||| |||||| | |||||||| || |||||||||| |
|
|
| T |
54726096 |
gctgaccttgatttggttgctgcaaacattataaaaggaggtttttcatacaggt |
54726042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University