View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1915_low_2 (Length: 418)
Name: NF1915_low_2
Description: NF1915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1915_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 280; Significance: 1e-156; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 280; E-Value: 1e-156
Query Start/End: Original strand, 96 - 395
Target Start/End: Complemental strand, 9949570 - 9949271
Alignment:
| Q |
96 |
tgttacctcttctgtctccgcgggttgtagttgtcgaacgaaacttgaatcagtgtggacaaaatcagattctccacacgaaaacttttcatcttctcca |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9949570 |
tgttacctcttctgtctccgcgggttgtagttgtcgaacgacacttgaatcagtgtggacaaaatcagattctccacacgaaaacttttcatcttctcca |
9949471 |
T |
 |
| Q |
196 |
cttgatagtttaactgaatcagagtccccagaccctgaattcaggaccgaccgtgttctggtaccaactgaaccatcgttcgatgaaatggtttcattaa |
295 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9949470 |
cttgatagcttaactgaatcagagtccccggaccctgaattcaggaccgaccgtgttctgataccaactgaaccatcgttcgatgaaatggtttcgttaa |
9949371 |
T |
 |
| Q |
296 |
ccacttcatcttgtgcttgtaacaaaatctcaaacaataacaacaatatagatattgttattgatgttgataaaaattctctagctagaaaagatgataa |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9949370 |
ccacttcatcttgtgcttgtaacaaaatctcaaacaataacaacaatatagatattgttattgatgttgataaaaattctctagctagaaaagatgataa |
9949271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University