View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1915_low_7 (Length: 250)
Name: NF1915_low_7
Description: NF1915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1915_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 11 - 183
Target Start/End: Original strand, 3008170 - 3008342
Alignment:
| Q |
11 |
cagagagaataacgaaagacacgtatgagaaccaaactaaccaacgaaagagaaatatgaggtatgttttttgtaattttgatacgttcagggattatag |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3008170 |
cagacagaataacgaaagacacgtatgagaaccaaactaaccaacgaaagagaaatatgaggtatgttttttgtaattttgatacgctcagggattatag |
3008269 |
T |
 |
| Q |
111 |
tgacaccgcctcacacactcaagaactaaaatgacaattgtagttacaacttccaacaagaggctcaagcaag |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3008270 |
tgacaccgcctcacacactcaagaactaaaatgacaattgtagttacaacttccaacaagaggctcaagcaag |
3008342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 78 - 116
Target Start/End: Complemental strand, 10765524 - 10765486
Alignment:
| Q |
78 |
tttttgtaattttgatacgttcagggattatagtgacac |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10765524 |
tttttgtaattttgatatattcagggattatagtgacac |
10765486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 88 - 144
Target Start/End: Complemental strand, 8353761 - 8353705
Alignment:
| Q |
88 |
tttgatacgttcagggattatagtgacaccgcctcacacactcaagaactaaaatga |
144 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||| | | | |||||||||| |
|
|
| T |
8353761 |
tttgatacgttcagggattatagtgacatcgtttcacacatttagggactaaaatga |
8353705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University