View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1915_low_8 (Length: 244)
Name: NF1915_low_8
Description: NF1915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1915_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 20 - 235
Target Start/End: Complemental strand, 13087847 - 13087632
Alignment:
| Q |
20 |
ccatggtggtacccagatccgtctgaggcgaggttgaggcggcaaacacgtgatttgatgcatggtccacgtccggtgaaggcatccacatttccgcgct |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13087847 |
ccatggtggtacccagatccgtctgaggcgaggttgaggcggcaaacacgtgagttgatgcatggtccacgtccggtgaaggcatccacatttccacgct |
13087748 |
T |
|
| Q |
120 |
cgaagtagttatgaccttctcccattgcaccccatgattttaggtttgggatccatactgattggttctttgcatcgtcgaatctaatgctgatttttga |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
13087747 |
cgaagtagttatgaccttctcccattgcaccccatgattttaggtttgggatccacactgattggttctttgcatcgtcgaatctaatgctgattttcga |
13087648 |
T |
|
| Q |
220 |
atctgttcctcctttg |
235 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
13087647 |
atctgttccacctttg |
13087632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University