View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19160_low_9 (Length: 248)
Name: NF19160_low_9
Description: NF19160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19160_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 45 - 170
Target Start/End: Original strand, 38714686 - 38714811
Alignment:
| Q |
45 |
aaacaaactactctgtaaatcagtttatttggggaaaattagtgtgaacataacatgcaattagtagtggtctatggtttcaacacaataaggctcttca |
144 |
Q |
| |
|
||||||| ||||||| ||| |||||||||| ||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38714686 |
aaacaaaatactctgcaaaacagtttatttaggggaaattaatgtgaacataacatgcaattagtagtggtctatggtttcaacacaataaggcttttca |
38714785 |
T |
|
| Q |
145 |
taatttcttgtaataatcaccatgta |
170 |
Q |
| |
|
||||||||||||||||||||| |||| |
|
|
| T |
38714786 |
taatttcttgtaataatcaccgtgta |
38714811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 184 - 229
Target Start/End: Original strand, 38714984 - 38715029
Alignment:
| Q |
184 |
tgtgataacttaacttgtaataatcactttgatgtttatcattttg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38714984 |
tgtgataacttaacttgtaataatcactttgatgtttatcattttg |
38715029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University