View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19161_high_23 (Length: 271)
Name: NF19161_high_23
Description: NF19161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19161_high_23 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 19 - 271
Target Start/End: Original strand, 40466394 - 40466643
Alignment:
| Q |
19 |
taaaatgatgctgactcgtctatagggaaccaaggaaaacttgatccaatgtcttatctgtgtttgtttatgtgtttctactttaattactatggtcccc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40466394 |
taaaatgatgctgactcgtctatagggaaccaaggaaaacttgatccaatgtcttatctgtgtttg----tgtgtttctactttaattactatggtcccc |
40466489 |
T |
|
| Q |
119 |
tctttaaccnnnnnnntctaaaaaccaaacacaattcgtggtcctatgtcaatatcattgtgnnnnnnnnnnnnnnnnnnnnnnnnnagtaaaataggta |
218 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40466490 |
tctttaaccaaaaaaatctaaaaaccaaacacaattcgtggtcctatgtcaatatcattgtgtttttattttattttttttccttttagtaaaataggta |
40466589 |
T |
|
| Q |
219 |
ctccaattgtttcaaagacttgtgat-agttgtgacacccaatagatagccctt |
271 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40466590 |
ctccaattgtttcaaagacttgtgatgagttgtgacacccaatagatagccctt |
40466643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University