View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19161_high_24 (Length: 250)
Name: NF19161_high_24
Description: NF19161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19161_high_24 |
 | |
|
| [»] scaffold0039 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0039 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 109697 - 109474
Alignment:
| Q |
17 |
caaaagtgcgttttgaataagttgatttggctcagttgcggtttggataatctgattggtttggaaaagcaatttgatcaatttgtggaggtaacgcacg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
109697 |
caaaagtgcgttttgaataagttgatttggttcagttgcggtttggataatctgattggtttggaaaagcaatttgatcaatttgtggaggtaacgcacg |
109598 |
T |
|
| Q |
117 |
tttgtatctcagcttctcaatagcacgtggactttgatattgggtctaggctgctcaagccaagaacctggaatttccaatggatttgggctactatgtt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
109597 |
tttgtatctcagcttctcaatagcacgtggactttgatattgggtctaggctgctcaagccaagaacctggaatttccaatggatttgggctactatgtt |
109498 |
T |
|
| Q |
217 |
tttgttactaagtgtacccctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
109497 |
tttgttactaagtgtacccctttg |
109474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University