View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19161_high_27 (Length: 229)
Name: NF19161_high_27
Description: NF19161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19161_high_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 32 - 214
Target Start/End: Complemental strand, 3293865 - 3293683
Alignment:
| Q |
32 |
tgatacacttgtgcttattggtgtaatttcaattctagtttcacattagagatacccatgttgaaaaattcaaaatgataaattagttcgactcgtagat |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
3293865 |
tgatacacttgtgcttattggtgtaatttcaattctaatttcacattagagatacccatgttgaaaaattcacaatgataaattagtttgactcgtagat |
3293766 |
T |
 |
| Q |
132 |
gtttggattgaccgtcaatttttcaaaatcacagaacatcaacttaagtatgataaaaattatgctttgaagttccaacaaat |
214 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3293765 |
gtttggattgaccgtcaattttccaaaatcatggaatatcaacttaagtatgataaaaattatgctttgaagttccaacaaat |
3293683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University