View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19161_low_27 (Length: 250)
Name: NF19161_low_27
Description: NF19161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19161_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 13 - 235
Target Start/End: Complemental strand, 33163750 - 33163529
Alignment:
| Q |
13 |
agaaagcctttaaccatcatcatcatcat---gataataaatcaaggtgacaaagaagatcaaacgaacacgttcaacaaatatgcttttgcttgtgcca |
109 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33163750 |
agaaagcctttaaccatcatcatcatcatcatgataataaatcaaggtgacaaagaagatcaaacgaacacgttcaacaaatatgcttttgcttgtgcca |
33163651 |
T |
|
| Q |
110 |
tagttgcttcaatggtgtccatcgtttctggttatggtacgtaattatcgcattctctaatctcttccactatgcgtgcgttgctccaatgnnnnnnnnc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
33163650 |
tagttgcttcaatggtgtccatcgtttctggttatggtacgtaattatcgcattctctaatctcttccactat----gcgttgctccaatgttttttttc |
33163555 |
T |
|
| Q |
210 |
ttttctagttttcactaatttgttat |
235 |
Q |
| |
|
| |||||||||||||||||||||||| |
|
|
| T |
33163554 |
tcttctagttttcactaatttgttat |
33163529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 83 - 148
Target Start/End: Complemental strand, 31990003 - 31989938
Alignment:
| Q |
83 |
tcaacaaatatgcttttgcttgtgccatagttgcttcaatggtgtccatcgtttctggttatggta |
148 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31990003 |
tcaacaaatatgcttttgcttgtgccattgttgcttcaatggtatccatcgtttctggttatggta |
31989938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University