View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19161_low_28 (Length: 247)

Name: NF19161_low_28
Description: NF19161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19161_low_28
NF19161_low_28
[»] chr3 (1 HSPs)
chr3 (44-232)||(48718701-48718889)


Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 44 - 232
Target Start/End: Original strand, 48718701 - 48718889
Alignment:
44 aaatcttctcttttttcccataaagaaattgatcctttaaatttgacaacacatcaacatcaatgtttttagatttcgtttatatcgatagatagctcga 143  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
48718701 aaatcttctcttttttcccataaagaaattgatcctttaaatttgacaacacatcaacatcaatgtttttagatttcgtttatatcgatagatagcttga 48718800  T
144 aagatttcatagagtttactctttcttttcttttgagagtgatgattatctaacataaacaattttcgttgttgtagaaattgttttct 232  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
48718801 aagatttcatagagtttactctttcttttcttttgagagtgatgattatctaagataaacaattttcgttgttgtagaaattgttttct 48718889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University