View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19161_low_31 (Length: 226)
Name: NF19161_low_31
Description: NF19161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19161_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 38 - 192
Target Start/End: Complemental strand, 34723097 - 34722937
Alignment:
| Q |
38 |
cctaacactttgataatcatcataagaataatgaaagtaaagatcagattttttattaaaaaagatttgannnnnnnngtgtttgacgttgccattcaaa |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34723097 |
cctaacactttgataatcatcataagaataatgaaagtaaagatcagatttgttattaaaaaagatttgattttttttgtgtttgacgttgccattcaaa |
34722998 |
T |
 |
| Q |
138 |
tgtgtttgtatcttttttgacttatcatgtt------ctgagatagataagtttccatgag |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34722997 |
tgtgtttgtatcttttttgacttatcatgttctgagactgagatagataagtttccatgag |
34722937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 130 - 192
Target Start/End: Complemental strand, 34732558 - 34732496
Alignment:
| Q |
130 |
cattcaaatgtgtttgtatcttttttgacttatcatgttctgagatagataagtttccatgag |
192 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||| ||||||||||| ||||||| |||||| |
|
|
| T |
34732558 |
cattcaaatgtgtttgcgtcttttttgactaatcattttctgagatagttaagttttcatgag |
34732496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University