View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19161_low_32 (Length: 224)
Name: NF19161_low_32
Description: NF19161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19161_low_32 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 7 - 224
Target Start/End: Complemental strand, 56179770 - 56179553
Alignment:
| Q |
7 |
gaaaacttgacatctaagaaagcagcaggtatatatgaatcatgctcacgtgtcgcttttgggaaatttttggtgaaattataataataaagcatgaaac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56179770 |
gaaaacttgacatctaagaaagcagcaggtatatatgaatcatgctcacgtgtcgcttttgggaaatttttggtgaaattataataataaagcatgaaac |
56179671 |
T |
 |
| Q |
107 |
ataaattggtgtagacataatgaataatgccaaagacatgcgagtatatatatgtacttggtaataagtatggcttggaaaggctttcttcaaaatggcc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56179670 |
ataaattggtgtagacataatgaataatgccaaagacatgcgagtatatatatgtacttggtaataagtatggcttggaaaggctttcttcaaaatggcc |
56179571 |
T |
 |
| Q |
207 |
atagtcaattcacacttc |
224 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
56179570 |
atagtcagttcacacttc |
56179553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University