View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19161_low_36 (Length: 210)
Name: NF19161_low_36
Description: NF19161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19161_low_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 55 - 191
Target Start/End: Original strand, 31413077 - 31413213
Alignment:
| Q |
55 |
tgatcatgtggagcaagatatcatattggtttgatacacacatttaatgcaccattggaatatggaaggggaaaatttgaatttcaaaccaatgtggtga |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31413077 |
tgatcatgtggagcaagatatcatattggtttgatacacacatttaatgcaccattggaatatggaaggggaaaatttgaatttcaaaccaatgtggtga |
31413176 |
T |
 |
| Q |
155 |
accgtgcaagtcaaataagagtaaatgcaattaaccc |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31413177 |
accgtgcaagtcaaataagagtaaatgcaattaaccc |
31413213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 69 - 191
Target Start/End: Complemental strand, 38014642 - 38014520
Alignment:
| Q |
69 |
aagatatcatattggtttgatacacacatttaatgcaccattggaatatggaaggggaaaatttgaatttcaaaccaatgtgg-tgaaccgtgcaagtca |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38014642 |
aagatatcatattggtttgatacacacatttaatgcgccattggaatatggaagagg-aaatttgaatttcaaaccaatgtggttgaaccgtgcaagtca |
38014544 |
T |
 |
| Q |
168 |
aataagagtaaatgcaattaaccc |
191 |
Q |
| |
|
||||| | |||||||||| ||||| |
|
|
| T |
38014543 |
aataacaataaatgcaatcaaccc |
38014520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University