View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19161_low_38 (Length: 203)

Name: NF19161_low_38
Description: NF19161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19161_low_38
NF19161_low_38
[»] chr2 (2 HSPs)
chr2 (29-118)||(31412855-31412944)
chr2 (101-139)||(31412953-31412991)


Alignment Details
Target: chr2 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 29 - 118
Target Start/End: Original strand, 31412855 - 31412944
Alignment:
29 aggcttcaaactatgcaaacatttctctgttataggctttaaactatgcaatcgtagaagcaaaatgaaaatgggtttggagatggagaa 118  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
31412855 aggcttcaaactatgcaaacatttctctgttataggcttcaaactatgcaatcgtagaagcaaaatgaaaatgggtttggagatggagaa 31412944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 101 - 139
Target Start/End: Original strand, 31412953 - 31412991
Alignment:
101 gggtttggagatggagaagaggatgaaggagttatgttt 139  Q
    ||||||||||||||||||  |||||||||||||||||||    
31412953 gggtttggagatggagaaagggatgaaggagttatgttt 31412991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University