View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19162_high_9 (Length: 233)

Name: NF19162_high_9
Description: NF19162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19162_high_9
NF19162_high_9
[»] chr2 (1 HSPs)
chr2 (130-210)||(36942372-36942453)


Alignment Details
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 130 - 210
Target Start/End: Complemental strand, 36942453 - 36942372
Alignment:
130 acacacacaagcacataaaaaataaatagcagcaagtttttctt-tctaaagttggcaaaatttattaaaaaagctcagccc 210  Q
    |||||||||||| ||||||||||||||||||||||||||||||| | | || ||||||||||||||| ||||||||||||||    
36942453 acacacacaagcccataaaaaataaatagcagcaagtttttcttgttttaaattggcaaaatttatttaaaaagctcagccc 36942372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University