View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19162_high_9 (Length: 233)
Name: NF19162_high_9
Description: NF19162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19162_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 130 - 210
Target Start/End: Complemental strand, 36942453 - 36942372
Alignment:
| Q |
130 |
acacacacaagcacataaaaaataaatagcagcaagtttttctt-tctaaagttggcaaaatttattaaaaaagctcagccc |
210 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| | | || ||||||||||||||| |||||||||||||| |
|
|
| T |
36942453 |
acacacacaagcccataaaaaataaatagcagcaagtttttcttgttttaaattggcaaaatttatttaaaaagctcagccc |
36942372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University