View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19162_low_10 (Length: 235)
Name: NF19162_low_10
Description: NF19162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19162_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 30347366 - 30347486
Alignment:
| Q |
1 |
gtgataatcaaccatttgttgtgtattggtacacaacctaagtgtgttatcaaatataaattggacaagatataagaagcaaataaccagtattagaggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
30347366 |
gtgataatcaaccatttgttgtgtattggtacacaacctaagtgtgttatcaaatataaattggacaagatataagaagcaaataaccagtatt----gt |
30347461 |
T |
 |
| Q |
101 |
ctt-agtaaaaaagatttctaatat |
124 |
Q |
| |
|
||| ||||||||||||||||||||| |
|
|
| T |
30347462 |
cttaagtaaaaaagatttctaatat |
30347486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 184 - 221
Target Start/End: Original strand, 30347478 - 30347515
Alignment:
| Q |
184 |
ttctaatattacttggccatattgatttaagaggtaaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30347478 |
ttctaatattacttggccatattgatttaagaggtaaa |
30347515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University