View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19163_high_22 (Length: 363)
Name: NF19163_high_22
Description: NF19163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19163_high_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 161 - 362
Target Start/End: Complemental strand, 14240075 - 14239874
Alignment:
| Q |
161 |
gtcgtgctttcaaaaacactaaccctaaccctaataacaacgctcagcagattcggaagcggagacggaactccaaaaacaagaaaaatgttcaaaatga |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14240075 |
gtcgtgctttcaaaaacactaaccctaaccctaataacaacgctcagcagattcggaagcggagacggaactccaaaaacaagaaaaatgttcaaaatga |
14239976 |
T |
 |
| Q |
261 |
cgatgatgaacctaattcgccgaattcagtacagaaagttgatgttagggttttgatttcgctgtttgagaaattagttagtgttatgggtttaattcat |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14239975 |
cgatgatgaacctaattcgccgaattcagtacagaaagttgatgttagggttttgatttcgctgtttgagaaattagttagtgttatgggtttaattcat |
14239876 |
T |
 |
| Q |
361 |
ct |
362 |
Q |
| |
|
|| |
|
|
| T |
14239875 |
ct |
14239874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University