View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19163_high_31 (Length: 307)
Name: NF19163_high_31
Description: NF19163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19163_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 45 - 278
Target Start/End: Original strand, 51190421 - 51190654
Alignment:
| Q |
45 |
gtgatggttgtctctgaataaagatttcaagatttggatcttcacttaaatttgaagggactcttaagaatcttgagctgaatgaaaaggtgaagtttct |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51190421 |
gtgatggttgtctctgaataaagatttcaagatttggatcttcacttaaatttgaagggactcttaagaatcttgagctgaatgaaaaggtgaagtttct |
51190520 |
T |
 |
| Q |
145 |
gatgtcactttcttcaaccatatacctgcaaagaggacaagtagagtgactttcaagccacttgtcaatacaattcatatgaaaagcatgcttgcatttc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51190521 |
gatgtcactttcttcaaccatatacctgcaaagaggacaagtagagtgactttcaagccacttgtcaatacaattcatatgaaaagcatgcttgcatttc |
51190620 |
T |
 |
| Q |
245 |
ggcaacaatctcagaatctcctcgtcttcaaatt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
51190621 |
ggcaacaatctcagaatctcctcgtcttcaaatt |
51190654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 269 - 301
Target Start/End: Complemental strand, 51190717 - 51190685
Alignment:
| Q |
269 |
tcttcaaattctcttctctaaaaggatccaaac |
301 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
51190717 |
tcttcaaattctcttctttaaaaggatccaaac |
51190685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University